pocketgull.app
Pocket Gull is a real-time clinical AI consult engine powered by Google Gemini. Features 10D multi-paradigm strategy, FHIR R4 export & 3D spatial anatomy.
First seen 2026-11-05 · Last seen 2026-11-05 · Source: webmcp.com
Answer 20 · Act 75 · Transact 3 · Score: Not yet scored
Tool inspector
evaluate_crispr_r_loop_energetics
Evaluates base-by-base thermodynamic free energy (ΔG) reaction coordinates, DNA unwinding torsional torque, seed-region mismatch penalties, and kinetic proofreading for CRISPR-Cas9/Cas12 off-target proofing.
Page: /
Input schema
| Property | Type | Required | Description |
|---|---|---|---|
guideRnaSeq |
string | no | 20-nt Guide RNA spacer sequence (default: "GACUUGACAGUCUACGAUCG") |
targetDnaSeq |
string | no | 20-nt Target DNA protospacer sequence (default: "GACTTGACAGTCTACGATCG") |
pamMotif |
string | no | PAM motif sequence (default: "NGG") |
superhelicalDensitySigma |
number | no | DNA superhelical topological density sigma (default: -0.06) |
Raw JSON schema
{
"type": "object",
"properties": {
"guideRnaSeq": {
"type": "string",
"description": "20-nt Guide RNA spacer sequence (default: \"GACUUGACAGUCUACGAUCG\")"
},
"targetDnaSeq": {
"type": "string",
"description": "20-nt Target DNA protospacer sequence (default: \"GACTTGACAGTCTACGATCG\")"
},
"pamMotif": {
"type": "string",
"description": "PAM motif sequence (default: \"NGG\")"
},
"superhelicalDensitySigma": {
"type": "number",
"description": "DNA superhelical topological density sigma (default: -0.06)"
}
}
}
Similar websites
webmcp-six-lac.vercel.app
AI Navigation Layer: Model Context Protocol (MCP) Semantic DOM integration for intelligent, safe, and observable web navigation.
ghqsandbox.net
Interactive math and physics tools an AI agent can drive directly through WebMCP.
app.formative.com
Formative classroom assessment and learning platform
seqcraft.onrender.com
Inspect plasmids, simulate PCR and restriction digests, compare constructs, and prepare cloning proposals in one exact, private workspace.